General ---------Biology----------------------------------------------------- ------------------Online--------------------------------------- Ch. 5 Macromolecules:  carbohydrates, fats, proteins, nucleic acids

Diseases can be caused by three things: 

1) bacteria, viruses or parasites (e.g. worms, fungi, etc.)
2) mental stress and/or allergic reactions
3) genetic diseases that result from mutations in a person's DNA

Your DNA is made up of 46 very long molecules.  You can visualize a DNA molecule as a long cassette tape.  The tape is divided into certain songs or, more accurately, into certain instructions that your tape player uses to produce a certain song.  Your DNA molecule is divided into certain genes, i.e. certain instructions that your cells uses to produce a certain protein. 

You can inherit a mutated gene from one or both of your parents, or you might inherit good genes and they mutate due to 
tobacco, alcohol, radiation, etc. during your life time.  (You can buy a cassette tape that has a defect in one of its songs, or the defect can happen many months after purchase.)

Genes are instructions, or recipes, for making proteins.  If the recipe, the gene, has a mistake in it, then the protein it codes for will have a mistake in it and fail to work properly.  Proteins are long chains of amino acid molecules.  If the gene's first instruction contains a mistake, a mutation, then the cell will start the protein off with the wrong amino acid in first place.  Proteins look like coiled up chains of amino acids linked together in series.  There are 20 different amino acids your cells use to assemble proteins.

Genetic disease: 

• A mistake in a gene causes a mistake in the sequence of amino acids making up a protein.  A short gene may have the base sequence shown in the first nucleotide sequence.  The mutated version, second line, has how many changes in the base sequence?  Which base has changed?

ATTCGGACTACTGCTTACGTEGEG

TTTCGGACTACTGCTTACGTEGEG

• Inherited diseases are caused by inherited mutations in the DNA you get from your parents egg and sperm.
• The mutation produces a protein with the wrong amino acid sequence.
• The "misspelled" protein is dysfunctional, often because it has the wrong shape. 
• For example, people with Sickle Cell Anemia have a mutation in their gene for making the protein hemoglobin, and their hemoglobin proteins fails to carry oxygen well.  The same thing is true for cystic fibrosis, Hunting ton's disease, certain cancers, Tay Sachs disease and many others; each results from a misspelled protein that fails to work.
• You get two copies of each gene you have, one from your mother and the other copy from your father.
• If you inherit a functional gene from one parent, a mutated gene from the other, then, in certain diseases, you are said to be a "carrier" of the disease.  Carriers lack the full blown symptoms of the disease but may pass on the defective gene to their children.

back to Ch. 5 Contents

---